View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14728_low_64 (Length: 218)
Name: NF14728_low_64
Description: NF14728
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14728_low_64 |
 | |
|
| [»] scaffold0013 (1 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 15 - 203
Target Start/End: Complemental strand, 40949251 - 40949063
Alignment:
| Q |
15 |
caaaggaagctgttggtcgttttattgaagcatggaagagagctagcaatgaccaaccagtttgggaaacacttgatttctcaatgttgaaatctgattt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40949251 |
caaaggaagctgttggtcgttttattgaagcatggaagagagctagcaatgaccaaccagtttgggaaacacttgatttctcaatgttgaaatctgattt |
40949152 |
T |
|
| Q |
115 |
tgtgaaggcctcaattcagccatatgtttgggtccattcccgttctgacagcacgttgtacaatttgctatttcttgcattgaatatca |
203 |
Q |
| |
|
||| ||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
40949151 |
tgtaaaggcctcaattcagccatatatttgggtccattcccgttctgacagcactttgtacaatttgctatttcttgcattgaatatca |
40949063 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 62; Significance: 6e-27; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 32 - 181
Target Start/End: Original strand, 45653112 - 45653261
Alignment:
| Q |
32 |
cgttttattgaagcatggaagagagctagcaatgaccaaccagtttgggaaacacttgatttctcaatgttgaaatctgattttgtgaaggcctcaattc |
131 |
Q |
| |
|
||||||| |||||||| || || |||||||| || |||||| ||||||||||||||||||||||| |||||||||||||| ||||||||| | || | |
|
|
| T |
45653112 |
cgttttactgaagcattgacgaaagctagcactgtccaaccggtttgggaaacacttgatttctccatgttgaaatctgaatttgtgaagactccatctg |
45653211 |
T |
|
| Q |
132 |
agccatatgtttgggtccattcccgttctgacagcacgttgtacaatttg |
181 |
Q |
| |
|
|||||| |||||||||| |||| | ||||||| ||| |||||||||||| |
|
|
| T |
45653212 |
agccatttgtttgggtcaattctggctctgacaacactttgtacaatttg |
45653261 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0013 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0013
Description:
Target: scaffold0013; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 75 - 115
Target Start/End: Complemental strand, 40934 - 40894
Alignment:
| Q |
75 |
tttgggaaacacttgatttctcaatgttgaaatctgatttt |
115 |
Q |
| |
|
||||| |||||||||||||||| ||||||| |||||||||| |
|
|
| T |
40934 |
tttggcaaacacttgatttctccatgttgagatctgatttt |
40894 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University