View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14729_high_1 (Length: 306)
Name: NF14729_high_1
Description: NF14729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14729_high_1 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 14 - 290
Target Start/End: Complemental strand, 24993352 - 24993080
Alignment:
| Q |
14 |
gcacagagagagccaaaaacctgtgaccgaattttcatcgatatcatcttgttcatatttgagccgctccaacacattatttaacaataataaatcagtt |
113 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
24993352 |
gcacagagagagccaaaaaccagtgaccgaattttcatcgatatcatctcgttcatattttagccgctccaacacattatttaacaatattaaatcagtt |
24993253 |
T |
|
| Q |
114 |
tactgcacatgctagcattttgcagatgccatacttgttgtaaatttgcagctttagttttgtattcaaaagctatatagataaatatacacacacattc |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
24993252 |
tactgcacatgctagcattttgcagatgccatacttgttgtaaatttgcagctttagttttgtattcaaaagctatatatctaaatata----cacattc |
24993157 |
T |
|
| Q |
214 |
atctacacacaaacctttaagagtgctgatttacaccgttgattctatcaccagccacaccctacaatagatatcac |
290 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
24993156 |
atctacacacaaacctttacgagtgctgatttacaccgttgatactatcaccagccacaccctacaatagatatcac |
24993080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 206 - 274
Target Start/End: Complemental strand, 1618173 - 1618104
Alignment:
| Q |
206 |
acacattcatctacacacaaacctttaagagtgctgatttacaccgttgatt-ctatcaccagccacacc |
274 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |||||||| || ||| |||||| ||||||||| |
|
|
| T |
1618173 |
acacattcatctaagcacaaacctttaagagtgctggtttacacccttaattattatcacaagccacacc |
1618104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University