View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1472_high_21 (Length: 235)
Name: NF1472_high_21
Description: NF1472
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1472_high_21 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 1 - 116
Target Start/End: Original strand, 31410239 - 31410354
Alignment:
| Q |
1 |
ataaatattaacaatgaaatttcataaatgaagaagcaatttatggaatatcagttaggcattttcaccattatatctattaatttaattannnnnnnac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
31410239 |
ataaatattaacaatgaaatttcataaatgaagaagcaatttatggaatatcagttaggcattttcaccattatatctattaatttaattatttttttac |
31410338 |
T |
 |
| Q |
101 |
gcaaacatactcatgg |
116 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
31410339 |
gcaaacatactcatgg |
31410354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 188 - 220
Target Start/End: Original strand, 31410425 - 31410457
Alignment:
| Q |
188 |
ggttactgagtcattagtttttatggttgaacc |
220 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |
|
|
| T |
31410425 |
ggttactcagtcattagtttttatggttgaacc |
31410457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University