View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1472_low_13 (Length: 371)
Name: NF1472_low_13
Description: NF1472
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1472_low_13 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 318; Significance: 1e-179; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 318; E-Value: 1e-179
Query Start/End: Original strand, 19 - 371
Target Start/End: Original strand, 40648409 - 40648755
Alignment:
| Q |
19 |
aatcagccattttctgaaccttttgcagagcaccgaacgagagaaagaaggatttgtgtgtgaccacaagtagtttgtggccttttggaaaaggatctag |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
40648409 |
aatcagccattttctgaaccttttgcagagcaccgaacgagagaaagaaggatttttgtgtgaccacaagtagtttgtggccttttggagaaggatctag |
40648508 |
T |
|
| Q |
119 |
aactgtttaggaggagtaggagagacgtttatgtttgatttgatttgagggtttgtgcacacgaaataagataattgtatgattgccacgtgtcaggtct |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
40648509 |
aactgtttaggaggagtaggagagacgtttatgtttgatttgatttgagggtttgtgcacacgaaataagataattgtatgattgccacgtgtccggtct |
40648608 |
T |
|
| Q |
219 |
gatttcgatttaacggctcagatgatgactctctcgcgatacggaaacggtagtattttattttaaattttttacgtatacttatacttcattcagaaca |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
40648609 |
gatttcgatttaacggctcagatgatgactctctcgcgatacggaaacggtagtattttattttaaattttttacg------tatacttcattcagaaca |
40648702 |
T |
|
| Q |
319 |
ggtccaattgtcctaaacatggtcggtgcagctgtatcccgtttcacattttt |
371 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40648703 |
ggtccaattgtcctaaacatggtcggtgcagctgtatcccgtttcacattttt |
40648755 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University