View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1472_low_20 (Length: 306)
Name: NF1472_low_20
Description: NF1472
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1472_low_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 20 - 296
Target Start/End: Complemental strand, 52112219 - 52111943
Alignment:
| Q |
20 |
cgtgaaacagaacaacctacggctggtaataagcaatgtcctggaaaggattttgttgtgttgttttctagacttttggtggtggaactgtttcttcgtt |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52112219 |
cgtgaaacagaacaacctacggctggtaataagcaatgtcccggaaaggattttgttgtgttgttttctagacttttggtggtggaactgtttcttcgtt |
52112120 |
T |
 |
| Q |
120 |
atgatacttttggtattcaagttggaaaatctcctataggatctgctgttacctttacctctctcaagaaagctaaattttagttttgtagttttgtttt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52112119 |
atgatacttttggtattcaagttggaaaatctcctataggatctgctgttacctttacctctctcaagaaagctaaattttagttttgtagttttgtttt |
52112020 |
T |
 |
| Q |
220 |
acttcataatacattttctggattaattattaattgtttaattgcatgtatatgcatgatgcatcccgcagcctatg |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
52112019 |
acttcataatacattttctggattaattattaattgtttaattgcatgtatatgcatgatgcatcccgcagcttatg |
52111943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University