View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1472_low_21 (Length: 303)
Name: NF1472_low_21
Description: NF1472
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1472_low_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 5 - 290
Target Start/End: Original strand, 1538803 - 1539084
Alignment:
| Q |
5 |
aaaataaaaatggtctccctatataagaggaaacacccagccgaagcacaacaagcagccccccaaaaagaaactaacccgcacccttgttccggaaagc |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| ||| |
|
|
| T |
1538803 |
aaaataaaaatggtctccctatataagaggaaacacccagccgaagcacaacaagcagtcccccgaaaagaaactaacccgcacccttgttccggacagc |
1538902 |
T |
 |
| Q |
105 |
tgggaattaagcaactgagacagcacccaagccagaaaacagaccgaactagcgcagaaaacagcacaccaaacgtgttgtacagcacccagcaaaaaca |
204 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1538903 |
tgggaa----gcaactgagacagcacccaagccagaaaacagaccgaactagcgcagaaaacagcacaccaaacgtgttgtacagcacccagcaaaaaca |
1538998 |
T |
 |
| Q |
205 |
gccatcaaatacaacaggactccaagcacataaaacacaccactatgcaccactgcccgcaaacttagcctctttgtaaaaaatct |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
1538999 |
gccatcaaatacaacaggactccaagcacataaaacacaccactatgcaccactgcacacaaacttagcctctttgtaaaaaatct |
1539084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University