View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1472_low_30 (Length: 243)
Name: NF1472_low_30
Description: NF1472
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1472_low_30 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 27900590 - 27900808
Alignment:
| Q |
1 |
aaaaacaaaacagaaacaaagaccgcccgttaaaaacagaaaggcggtgttctaatctaatatccgg-aaaaacataaaacctccgacaagcccatctga |
99 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||| |||||||| |||| |
|
|
| T |
27900590 |
aaaaacaaaacagaaacaaagaccgtccgttaaaaacagaaaggcggtgttctaatctaatatccggaaaaaacacaaaacctccggcaagcccaactga |
27900689 |
T |
 |
| Q |
100 |
aaccacaaactaagaccaacatgaaacatagccaaaatcttcgaaccaacatatc-acctaaattgattctcgattgctatattctaatgttgttatttt |
198 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||| ||| || |||||||||||| |||||||| ||| ||||||||||||||| |
|
|
| T |
27900690 |
aaccacaaaccgagaccaacatgaaacatagccaaaatcttcgaaccaacagatcaacgtaaattgattcttgattgctacattttaatgttgttatttt |
27900789 |
T |
 |
| Q |
199 |
acacaaacttgataaagtt |
217 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
27900790 |
acacaaacttgataaagtt |
27900808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University