View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1472_low_32 (Length: 240)

Name: NF1472_low_32
Description: NF1472
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1472_low_32
NF1472_low_32
[»] chr7 (1 HSPs)
chr7 (6-225)||(23118004-23118223)


Alignment Details
Target: chr7 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 6 - 225
Target Start/End: Complemental strand, 23118223 - 23118004
Alignment:
6 aggaatatactaaaatatccgaaaagcagcggacttacctgtccatgcagaccccagccaaaagtaagaagagccccagtatctacaaaagcaatttata 105  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23118223 aggaatatactaaaatatccgaaaagcagcggacttacctgtccatgcagaccccagccaaaagtaagaagagccccagtatctacaaaagcaatttata 23118124  T
106 aacaatgttagaatttcttttatcgagtgcttaattgaacttgcatatctattgagtgcttaattgaacttggatatctttgaacaacattgagaataga 205  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23118123 aacaatgttagaatttcttttatcgagtgcttaattgaacttgcatatctattgagtgcttaattgaacttggatatctttgaacaacattgagaataga 23118024  T
206 catttagtaactgatataca 225  Q
    ||||||||||||||||||||    
23118023 catttagtaactgatataca 23118004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University