View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1472_low_35 (Length: 232)
Name: NF1472_low_35
Description: NF1472
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1472_low_35 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 1 - 81
Target Start/End: Original strand, 8649837 - 8649917
Alignment:
| Q |
1 |
atgaagccaaacaacaaattgaattgaaaatactagatctggctgaaaaaactatgaaagctagtaaaacaacaaacaact |
81 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
8649837 |
atgaagccaaacaacagattgaattgaaaatactagatctggaagaagaaactatgaaagctagtaaaacaacaaacaact |
8649917 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 76 - 199
Target Start/End: Original strand, 8668267 - 8668388
Alignment:
| Q |
76 |
acaactaaaaccacaatatttaaaatannnnnnntgacagaaggggaggttctgatgtaacagatctggcttttagatggcccaatacaaaatgaggagg |
175 |
Q |
| |
|
||||||||||||||||| ||||||||| ||||||||||||||||||||||||| ||||| ||||||||||||||| || | ||||||||||| |
|
|
| T |
8668267 |
acaactaaaaccacaatctttaaaataggggg--tgacagaaggggaggttctgatgtaccagattcggcttttagatggccaaaaaagaaatgaggagg |
8668364 |
T |
|
| Q |
176 |
agagatttcggtggagggaggtat |
199 |
Q |
| |
|
||||||| |||||||||||||||| |
|
|
| T |
8668365 |
agagattccggtggagggaggtat |
8668388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University