View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14730_high_11 (Length: 336)
Name: NF14730_high_11
Description: NF14730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14730_high_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 16 - 329
Target Start/End: Complemental strand, 55321390 - 55321080
Alignment:
| Q |
16 |
caggaattagtgaatgatctcaagtcagttatccttgcacaataaggtaaattaattttgaatgtctaatctttcttagatgtatagtgcagtggaaatt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55321390 |
caggaattagtgaatgatctcaagtcagttatccttgcacaataaggtaaattaattttgaatgtctaatctttcttagatgtatagtgcagtggaaatt |
55321291 |
T |
 |
| Q |
116 |
tggagtctttagaatgaacgaaaagtagcttgcttttctcttggttagcaccatttttatttcgattgtcatgatagccccagtattattacttgattag |
215 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
55321290 |
tggagtctttagaatgaatgaaaagtagcttgcttttctcttggttagcaccatttttatttcgattgtc---atagccccagtattattacttgattag |
55321194 |
T |
 |
| Q |
216 |
tattatttgtttaatgttatagtgatttatagtgtctttcaagctataatatattagttttgttgtttttaaattacagactgaaatagtttctcccaaa |
315 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55321193 |
tattatttgtttgatgttatagtgatttatagtgtctttcaagctataatatattagttttgttgtttttaaattacagactgaaatagtttctcccaaa |
55321094 |
T |
 |
| Q |
316 |
aagtagtataatct |
329 |
Q |
| |
|
||||| |||||||| |
|
|
| T |
55321093 |
aagtaatataatct |
55321080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University