View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14730_low_10 (Length: 379)
Name: NF14730_low_10
Description: NF14730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14730_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 275; Significance: 1e-154; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 7 - 293
Target Start/End: Complemental strand, 37476139 - 37475853
Alignment:
| Q |
7 |
atgtccaagaatatttctccatttgctcggagtgaacaaaatagtcacatacgactctggacataaaaaatttaaaaagttgtcatcatatcatattgtt |
106 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37476139 |
atgtccaattatatttctccatttgctcggagtgaacaaaatagtcacatacgactctggacataaaaaatttaaaaagttgtcatcatatcatattgtt |
37476040 |
T |
|
| Q |
107 |
attaaactcttaaaatacagtgtttggatctaagtcaaaccaacagaattctaaattcaatcagtgctgtcaaatagcggcttatggcacagcgaaattt |
206 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37476039 |
attaaactcttaaaatacagtgttcggatctaagtcaaaccaacagaattctaaattcaatcagtgctgtcaaatagcggcttatggcacagcgaaattt |
37475940 |
T |
|
| Q |
207 |
gaacaatcatattattgttcggcagtagccctacaccttttagtacaaacatcaggctgttaatttccaagcaaaccttgaatgaca |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37475939 |
gaacaatcatattattgttcggcagtagccctacaccttttagtacaaacatcaggctgttaatttccaagcaaaccttgaatgaca |
37475853 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 292 - 360
Target Start/End: Complemental strand, 37475831 - 37475762
Alignment:
| Q |
292 |
catggcttagcaataaaagaaagaacttnnnnnnn-tgcagaaatatgaaatcactaataagattaggct |
360 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
37475831 |
catggcttagcaataaaagaaagaacttaaaaaaaatgcagaaatatgaaatcactaataagattaggct |
37475762 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University