View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14730_low_15 (Length: 298)
Name: NF14730_low_15
Description: NF14730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14730_low_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 159; Significance: 1e-84; HSPs: 6)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 69 - 235
Target Start/End: Complemental strand, 712499 - 712333
Alignment:
| Q |
69 |
aataattaaataaaatgattgtgtacttattttttattgaaataataaaatggtgacacctcaaatacactcaaaactaacaacatttgtgaacaggatc |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
712499 |
aataattaaataaaatgattgtgtacttattttttattgaaataataaaatggtgacacctcaaatacactcaaaactaacaacatttgtgaacaggatc |
712400 |
T |
 |
| Q |
169 |
caattgcaaacaatgtccaaccaattgttgttgctccaattgctgctgtctcaattttggtcgatgc |
235 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
712399 |
caattgcaaacaatgttcaaccaattgttgttgctccaattgctgctgtctcaattttggttgatgc |
712333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 20 - 69
Target Start/End: Complemental strand, 712632 - 712583
Alignment:
| Q |
20 |
agtcgcataccaagtctaatgcatctaataaatggtgggaaatttgagga |
69 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
712632 |
agtcgcataccaaatctaatgcatctaataaatggtgggaaatttgagga |
712583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 81 - 144
Target Start/End: Complemental strand, 20038537 - 20038475
Alignment:
| Q |
81 |
aaatgattgtgtacttattttttattgaaataataaaatggtgacacctcaaatacactcaaaa |
144 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||||| ||||||| ||| |||||||||||| |||| |
|
|
| T |
20038537 |
aaatgattgtgtacttattttt-attcaaataatcaaatggtaacaactcaaatacactaaaaa |
20038475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 258 - 292
Target Start/End: Complemental strand, 711495 - 711461
Alignment:
| Q |
258 |
gttaagacaaaaagctgaagtattcaatagtataa |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
711495 |
gttaagacaaaaagctgaagtattcaatagtataa |
711461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 183 - 235
Target Start/End: Complemental strand, 20038408 - 20038356
Alignment:
| Q |
183 |
gtccaaccaattgttgttgctccaattgctgctgtctcaattttggtcgatgc |
235 |
Q |
| |
|
||||||| ||||||||||| ||||| ||||||| ||||||||||||| ||||| |
|
|
| T |
20038408 |
gtccaactaattgttgttggtccaactgctgctatctcaattttggttgatgc |
20038356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 69 - 102
Target Start/End: Complemental strand, 20111324 - 20111291
Alignment:
| Q |
69 |
aataattaaataaaatgattgtgtacttattttt |
102 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
20111324 |
aataattaaagaaaatgattgtgtacttattttt |
20111291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University