View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14730_low_25 (Length: 228)
Name: NF14730_low_25
Description: NF14730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14730_low_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 20 - 216
Target Start/End: Original strand, 24211476 - 24211672
Alignment:
| Q |
20 |
cgtcttgcttctcaatataaggtaatttaatttaacttcttaatcaaccattaatttggattattaatgatcaagattcaaaaagatgttccatactatc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24211476 |
cgtcttgcttctcaatataaggtaatttaatttaacttcttaatcaaccattaatttggattattaatgatcaagattcaaaaagatgttccatactatc |
24211575 |
T |
 |
| Q |
120 |
tagtatcaatggcgtgtgtccggtgtctgacatgtgtttgacacgatatctgatatctcgacacatgtagttagaatttaatcactgacatattctt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
24211576 |
tagtatcaatggcgtgtgtccggtgtctgacatgtgtttgacacgatatctgatatctcgacacatgtagttagaatttaatcactgacattttctt |
24211672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University