View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14730_low_27 (Length: 222)
Name: NF14730_low_27
Description: NF14730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14730_low_27 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 182; Significance: 1e-98; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 1 - 207
Target Start/End: Complemental strand, 38796247 - 38796041
Alignment:
| Q |
1 |
aatgtttagcaaaatgagagtttcacgcattcatccactctttgattaatcacagaactgaaattaactggcatcgatgcatgaacnnnnnnntgctccc |
100 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38796247 |
aatgtttagcaaaatgagagtttcacacattcatccactctttgattaatcacagaactgaaattaactggcatcgatgcatgaacaaaaaaatgctccc |
38796148 |
T |
|
| Q |
101 |
actctttgatttcacatttctctagtgcagcaacaattttcgtcctttctctttcatttggaaataacagtttggtaatacttttgtttttagttttgca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38796147 |
actctttgatttcacatttctctagtgcagcaacaattttcgtcctttctctttcatttggaaataacagtttggtaatacttttgtttttagttttgca |
38796048 |
T |
|
| Q |
201 |
gttcatc |
207 |
Q |
| |
|
||||||| |
|
|
| T |
38796047 |
gttcatc |
38796041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 95 - 165
Target Start/End: Complemental strand, 38423719 - 38423649
Alignment:
| Q |
95 |
gctcccactctttgatttcacatttctctagtgcagcaacaattttcgtcctttctctttcatttggaaat |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
38423719 |
gctcccactctttgatttcacatttctctagtgcagtaacaattttcgtcctctctctttcatttggaaat |
38423649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University