View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14733_high_10 (Length: 264)
Name: NF14733_high_10
Description: NF14733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14733_high_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 248
Target Start/End: Complemental strand, 36459182 - 36458930
Alignment:
| Q |
1 |
attgagaagcggctctgagagttgttgaagttcaaatcgagagtt-----gaagaaattccatcatcatgaccaaagtgaaggagaaagatgcttcaact |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| | |||||||||| | |
|
|
| T |
36459182 |
attgagaagcggctctgagagttgttgaagttcaaatcgagagttacgttgaagaaattccatcatcatgaccaaagtgaaggaggaggatgcttcaaat |
36459083 |
T |
 |
| Q |
96 |
aaacctattaagattcgtcaggtgtgggctgaaaatctgaagcgtgaatttgatcttataagaaatttcgttcacatgtttccctatgtatcaatggata |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
36459082 |
aaacctattaagattcgtcaggtgtgggctgaaaatctggagcgtgaatttgatcttataagagatttcgttcacatgtttccctatgtatcaatggata |
36458983 |
T |
 |
| Q |
196 |
ccgagtttcctggtgtcgtcgttgcacctaactttgatcccaatataccgtat |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36458982 |
ccgagtttcctggtgtcgtcgttgcacctaactttgatcccaatataccgtat |
36458930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University