View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14733_high_2 (Length: 438)
Name: NF14733_high_2
Description: NF14733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14733_high_2 |
 |  |
|
| [»] scaffold1019 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 142; Significance: 2e-74; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 8 - 161
Target Start/End: Original strand, 32489854 - 32490007
Alignment:
| Q |
8 |
attatactagaaatggctgacttccaagagattatcttattattaaaccttacacctctagtgcattggaaatatccttgagctttctcattcacataaa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32489854 |
attatactagaaatggctgacttccaagagattatcttattattgaaccttacacctttagtgcattggaaatatccttgagctttctcattcacataaa |
32489953 |
T |
 |
| Q |
108 |
tagagagaaatgctgatttaagaataacatcaatccaattgtagaaagtatcat |
161 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
32489954 |
tagagagaaatgctgatttaagaataacatcaatccaattgtagagagtatcat |
32490007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 190 - 286
Target Start/End: Original strand, 32490008 - 32490104
Alignment:
| Q |
190 |
aaaaatggtcactctagtgtgtcaaagactttgttgtgcaagagattaacagcttcagatgcaatgcacaaatagtctctaatgattatatcatgaa |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32490008 |
aaaaatggtcactctagtgtgtcaaagactttgttgtgcaagagattaacagcttcagatgcaatgcacaaatagtctctaatgattatatcatgaa |
32490104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1019 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold1019
Description:
Target: scaffold1019; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 106 - 171
Target Start/End: Original strand, 702 - 767
Alignment:
| Q |
106 |
aatagagagaaatgctgatttaagaataacatcaatccaattgtagaaagtatcattcaaaccaaa |
171 |
Q |
| |
|
|||||||||||| ||||| || ||||| |||||||||||||| ||||| |||||| |||||||| |
|
|
| T |
702 |
aatagagagaaaggctgactttagaatcacatcaatccaattacagaaaacatcattgaaaccaaa |
767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University