View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14733_high_8 (Length: 327)
Name: NF14733_high_8
Description: NF14733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14733_high_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 15 - 307
Target Start/End: Complemental strand, 20068609 - 20068317
Alignment:
| Q |
15 |
atatgacgtttttacgaacattaacaccaattctaactgcctaagggtcaatttcatagcctatagattttccaccaccagtttgccaataattagagtt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20068609 |
atatgacgtttttacgaacattaacaccaattctaactgcctaagggtcactttcatagcctatagattttccaccaccagtttgccaataattagagtt |
20068510 |
T |
 |
| Q |
115 |
ccataaacatattgtaaatgtgatactacttcatcttacctccccaccttgaagcctttaaagtaactcatatttaccgttttcttcattaaaccaccta |
214 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20068509 |
ccataaacatattgtaaaagtgatactacttcatcttacctccccaccttgaagcctttaaagtaactcatatttaccgttttcttcattaaaccaccta |
20068410 |
T |
 |
| Q |
215 |
cctcctccgccactaaaagtataagaaacggagccaaattgtcctcttgctttaagccccctgttaatgtatatttgtcattgtttaaatgtg |
307 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20068409 |
acccctccgccactaaaagtataagaaacggagccaaatgatgctcttgctttaagccccctgttaatgtatatttgtcattgtttaaatgtg |
20068317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University