View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14733_low_13 (Length: 250)
Name: NF14733_low_13
Description: NF14733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14733_low_13 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 201; Significance: 1e-110; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 16791393 - 16791156
Alignment:
| Q |
1 |
caaatgcatgcacgttatactttttt-gaataaaaccaagttcacttaaattattttgttaattggtggtagggcaattgcattgattcgacacggtccc |
99 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16791393 |
caaatgcatgcacgttatactttttttgaataaaaccaagttcacttaatttattttgttaattggtggtagggcaattgcattgattcgacacggtccc |
16791294 |
T |
|
| Q |
100 |
tgctgcagcagtatccagaagtgaagtgaacaagttgaaggaagatcagtataatttggtatttaa----gcaacttaggttcaaaaccagttgatagca |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
16791293 |
tgctgcagcagtatccagaagtgaagtgaacaagttgaaggaagatcagtataatttggtatttaattaggcaacttaggttcaaaaccagttgatagca |
16791194 |
T |
|
| Q |
196 |
acactcaaaccaccccactatgattgtatataaaattc |
233 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
16791193 |
acactcaaaccaccctgctatgattgtatataaaattc |
16791156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 103 - 192
Target Start/End: Complemental strand, 16866115 - 16866026
Alignment:
| Q |
103 |
tgcagcagtatccagaagtgaagtgaacaagttgaaggaagatcagtataatttggtatttaagcaacttaggttcaaaaccagttgata |
192 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||| ||||||| | ||||||||||| ||||||||||||| |||||||| |
|
|
| T |
16866115 |
tgcagcagtgtccagaagtgaagtgaacaagttgaaggaagataagtataaataagtatttaagcagcttaggttcaaaattagttgata |
16866026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 66 - 147
Target Start/End: Original strand, 17130830 - 17130909
Alignment:
| Q |
66 |
tggtagggcaattgcattgattcgacacggtccctgctgcagcagtatccagaagtgaagtgaacaagttgaaggaagatca |
147 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||| | ||||| | ||| ||||| |||||||||||||||| |||||| |
|
|
| T |
17130830 |
tggtaggccaattgcattgattcgaca--gtccctgccgaggcagtgttcagcagtgaggtgaacaagttgaaggcagatca |
17130909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University