View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14733_low_15 (Length: 218)
Name: NF14733_low_15
Description: NF14733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14733_low_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 21 - 202
Target Start/End: Complemental strand, 40052336 - 40052152
Alignment:
| Q |
21 |
atttaattaacacaacaccttgattatacggtgcagatgggtaattggatggtactgatcaaaaatggattcggaggaggaggagg---taaatcggcat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
40052336 |
atttaattaacacaacaccttgattatacggtgcagatgggtaattggatggtactgatcaaaaatggattcggaggaggaggaggaggtaaatcggcat |
40052237 |
T |
 |
| Q |
118 |
acacaacatcaactgtaccaaaaatgaaagcatatgctccaccagcatctgattatggacacattcatcacggacaacaacatgg |
202 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40052236 |
acacaacgtcaactgtaccaaaaatgaaagcatatgctccaccagcatctgattatggacacattcatcacggacaacaacatgg |
40052152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University