View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14733_low_16 (Length: 201)
Name: NF14733_low_16
Description: NF14733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14733_low_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 51 - 194
Target Start/End: Complemental strand, 22306023 - 22305880
Alignment:
| Q |
51 |
tttttaagaaaaatataaaaccctaaaccactcaccatgcaaattacagtgcaatgaagtttagccgttgaaatgtctttgcattgagcccaaccaatgt |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
22306023 |
tttttaagaaaaatataaaaccctaaaccactcagcatgcaaattacagtgcaatgaagtttagccgttgaaatgtctttgcattgagcccaaccaattt |
22305924 |
T |
|
| Q |
151 |
gtactagcttagaatcttgtttttgcaacacacttttcttctct |
194 |
Q |
| |
|
|| |||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
22305923 |
gtgctagcttagaatctcgtttttgcaacacacttttcttctct |
22305880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University