View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14734_high_10 (Length: 291)
Name: NF14734_high_10
Description: NF14734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14734_high_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 264; Significance: 1e-147; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 10 - 277
Target Start/End: Original strand, 50369697 - 50369964
Alignment:
| Q |
10 |
catagggtagtaatggttttgaatataggtagcacgaattgtgcgggattcaccgtgggaagagccacggtggtggagaaagtcaaattgttcaagcaag |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50369697 |
catagggtagtaatggttttgaatataggtagcacgaattgtgcgggattcaccgtgggaagagccacggtggtggagaaagtcaaattgttcaagcaag |
50369796 |
T |
|
| Q |
110 |
agtgttttgagaccccttttggctgcttggtaggcggtggaacttcccatgacgccggctccgacaataatcacgtcaaactgagaatcctccatggata |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50369797 |
agtgttttgagaccccttttggctgcttggtaggcggtggaacttcccatgacgccggctccgacaataatcacgtcaaactgagaatcctccatggata |
50369896 |
T |
|
| Q |
210 |
ggatcaagtttttaaaaagggaaaaggattgagggagttgagtgttggtgatgctgatgcagtgtgtg |
277 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50369897 |
ggatcaagtttttaacaagggaaaaggattgagggagttgagtgttggtgatgctgatgcagtgtgtg |
50369964 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 44 - 180
Target Start/End: Original strand, 50379897 - 50380033
Alignment:
| Q |
44 |
cgaattgtgcgggattcaccgtgggaagagccacggtggtggagaaagtcaaattgttcaagcaagagtgttttgagaccccttttggctgcttggtagg |
143 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||||||| ||||| || |||||||| || | || |||||||| || | |||||| || | ||||| |
|
|
| T |
50379897 |
cgaattgtgcgggattcaccgtgggaggaaccacggtggtgaagaaaatcgaattgttcgagaaccagggttttgaggcctcgtttggcagcgtagtagg |
50379996 |
T |
|
| Q |
144 |
cggtggaacttcccatgacgccggctccgacaataat |
180 |
Q |
| |
|
||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
50379997 |
cggtggagcttcccatgacgccggcgccgacaataat |
50380033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University