View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14734_low_6 (Length: 394)
Name: NF14734_low_6
Description: NF14734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14734_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 239; Significance: 1e-132; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 16 - 262
Target Start/End: Complemental strand, 46115991 - 46115745
Alignment:
| Q |
16 |
ataaagtgagaggtgatccttttataggcatctatctctataagcaccccaaaaatgaactctacaatgagatatctatttagctcggagctaaatgcgc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46115991 |
ataaagtgagaggtgatccttttataggcatctatctctataagcacccaaaaaatgaactctacaatgagatatctatttagctcggagctaaatgcgc |
46115892 |
T |
 |
| Q |
116 |
aaagcatccacatttttatagatagtcttagaaatttgtaatttcaaaattaagtttttgattgctaattaattaatattggtgataaatgtgctaggac |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46115891 |
aaagcatccacatttttatagatagtcttagaattttgtaatttcaaaattaagtttttgattgctaattaattaatattggtgataaatgtgctaggac |
46115792 |
T |
 |
| Q |
216 |
attgtgatttcaaaattaagtttgtgatttctaatcaatatcgtgta |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46115791 |
attgtgatttcaaaattaagtttgtgatttctaatcaatatcgtgta |
46115745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 333 - 366
Target Start/End: Complemental strand, 46117486 - 46117453
Alignment:
| Q |
333 |
ggttgtctaactcaactggttttagctaaacaat |
366 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
46117486 |
ggttgtctaactcaactggttttagctaaacaat |
46117453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University