View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14735_low_2 (Length: 438)
Name: NF14735_low_2
Description: NF14735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14735_low_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 91; Significance: 6e-44; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 91; E-Value: 6e-44
Query Start/End: Original strand, 263 - 361
Target Start/End: Complemental strand, 16904077 - 16903979
Alignment:
| Q |
263 |
gagactagcaaatattgtattgttaaagtcagctgctgtataaaactttttatcatctgggacaatattggctgcttttagaatagcatctagatttat |
361 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16904077 |
gagactagcaaatattgtattgttaaagtcggctgttgtataaaactttttatcatctgggacaatattggctgcttttagaatagcatctagatttat |
16903979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 263 - 361
Target Start/End: Complemental strand, 16992571 - 16992473
Alignment:
| Q |
263 |
gagactagcaaatattgtattgttaaagtcagctgctgtataaaactttttatcatctgggacaatattggctgcttttagaatagcatctagatttat |
361 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16992571 |
gagactagcaaatattgtattgttaaagtcggctgttgtataaaactttttatcatntgggacaatattggctgcttttagaatagcatctagatttat |
16992473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University