View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14735_low_7 (Length: 262)
Name: NF14735_low_7
Description: NF14735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14735_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 158; Significance: 4e-84; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 18 - 249
Target Start/End: Original strand, 54084498 - 54084753
Alignment:
| Q |
18 |
agtagcaaggaaggatttgggtttggaccttggtgggttgggaattggacttggtgcaggagtaggcttgggaattggaggtggcagtggctctggagcc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54084498 |
agtagcaaggaaggatttgggtttggacctcggtgggttgggaattggacttggtgcaggagtaggcttgggaattggaggtggcagtggctctggagcc |
54084597 |
T |
|
| Q |
118 |
ggagcaggagctggct------------------ctggctctggttctagttct------tcctcaagttcatcatcatcttcatcttctagttccggtt |
193 |
Q |
| |
|
|||||||||||||||| |||||||||| ||| ||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54084598 |
ggagcaggagctggctctggagccggagcaggagctggctctggctctggttctagttcttcctcaagttcatcatcatcttcatcttctagttccggtt |
54084697 |
T |
|
| Q |
194 |
ccggttctggggcagggtcggaggcaggctcatatgcaggctcccgggctggttcg |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
54084698 |
ccggttctggggcagggtcggaggcaggctcatatgcaggctctcgggctggttcg |
54084753 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 25 - 249
Target Start/End: Original strand, 54081126 - 54081350
Alignment:
| Q |
25 |
aggaaggatttgggtttggaccttggtgggttgggaattggacttggtgcaggagtaggcttgggaattggaggtggcagtggctctggagccggagcag |
124 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||| || || ||||||||||||||||||||||||||||||||||| | |
|
|
| T |
54081126 |
aggaaggatttgggtttggaccttggtggattgggaattggacttggtgcaggagttggtttaggaattggaggtggcagtggctctggagccggagctg |
54081225 |
T |
|
| Q |
125 |
gagctggctctggctctggttctagttcttcctcaagttcatcatcatcttcatcttctagttccggttccggttctggggcagggtcggaggcaggctc |
224 |
Q |
| |
|
| || |||||||| ||||||||||| ||||||||||||||||| || ||||| ||||||||||| || || ||||| |||||||||||||| |||||||| |
|
|
| T |
54081226 |
gtgcaggctctggttctggttctagctcttcctcaagttcatcgtcctcttcgtcttctagttctgggtctggttccggggcagggtcggaagcaggctc |
54081325 |
T |
|
| Q |
225 |
atatgcaggctcccgggctggttcg |
249 |
Q |
| |
|
|||||||||||| |||||||||||| |
|
|
| T |
54081326 |
atatgcaggctctcgggctggttcg |
54081350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University