View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14736_high_17 (Length: 204)
Name: NF14736_high_17
Description: NF14736
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14736_high_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 60; Significance: 9e-26; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 132 - 191
Target Start/End: Complemental strand, 11151305 - 11151246
Alignment:
| Q |
132 |
catgaagaattccacaaatcaatattagtagtttaattttaatttctcacttcctatgct |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11151305 |
catgaagaattccacaaatcaatattagtagtttaattttaatttctcacttcctatgct |
11151246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 19 - 70
Target Start/End: Complemental strand, 11151354 - 11151303
Alignment:
| Q |
19 |
tcttctatgttttttcatttgacattaattttatgtgcagtaatgaagacat |
70 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
11151354 |
tcttctatgttttttcatttgacattaattttatgttcagtaatgaagacat |
11151303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 98 - 177
Target Start/End: Original strand, 11172945 - 11173028
Alignment:
| Q |
98 |
ggatatgaagaagttagttgtaacatataacaatcatgaagaattccacaaatcaa--tattag--tagtttaattttaatttc |
177 |
Q |
| |
|
|||| ||||||||||||| | ||||||||||||||||||| ||| |||||| ||| |||||| ||||||||||| |||||| |
|
|
| T |
11172945 |
ggatctgaagaagttagtggaaacatataacaatcatgaacaatctcacaaaccaatttattagtatagtttaatttcaatttc |
11173028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University