View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14736_low_10 (Length: 344)
Name: NF14736_low_10
Description: NF14736
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14736_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 109; Significance: 9e-55; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 109; E-Value: 9e-55
Query Start/End: Original strand, 18 - 145
Target Start/End: Complemental strand, 43183995 - 43183867
Alignment:
| Q |
18 |
tcaggtgcttcattcgtgactccttcagacagtttgttacagcttttgctgggtgggaaagcttttgttcgtgactccgaaactgttagttcatgagggg |
117 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
43183995 |
tcaggtgcttcgttcgtgactccttcagacagtttgttacagcttttgctgggttggaaagcttttattcgtgactccgaaactgttagttcatgagggg |
43183896 |
T |
 |
| Q |
118 |
gaagc-tttgcagtactctcagctgtgaa |
145 |
Q |
| |
|
||||| ||||||||||||||||||||||| |
|
|
| T |
43183895 |
gaagcttttgcagtactctcagctgtgaa |
43183867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 144 - 258
Target Start/End: Complemental strand, 43183210 - 43183096
Alignment:
| Q |
144 |
aaaataattttgctcattcacagacaagagacatccatagttagtttgnnnnnnnnnnnnngatttgcttgataaagtatgaagaatgtctattgaagat |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43183210 |
aaaataattttgctcattcacagacaagagacatccatagttagtttgaaaaaaaaaaaaagatttgcttgataaagtatgaagaatgtctattgaagat |
43183111 |
T |
 |
| Q |
244 |
atgaatagtcatgta |
258 |
Q |
| |
|
| ||||||||||||| |
|
|
| T |
43183110 |
aggaatagtcatgta |
43183096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 87; Significance: 1e-41; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 205 - 311
Target Start/End: Complemental strand, 30791053 - 30790947
Alignment:
| Q |
205 |
gatttgcttgataaagtatgaagaatgtctattgaagatatgaatagtcatgtatttccatgaatgaaaaaatgtaaaaattagacacaatcaacacaga |
304 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30791053 |
gatttgcttgagaaaatatgaagaatgtctattgaagataggaatattcatgtatttccatgaatgaaaaaatgtaaaaattagacacaatcaacacaga |
30790954 |
T |
 |
| Q |
305 |
aatacta |
311 |
Q |
| |
|
|| |||| |
|
|
| T |
30790953 |
aacacta |
30790947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University