View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14737_high_12 (Length: 240)
Name: NF14737_high_12
Description: NF14737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14737_high_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 7566070 - 7565848
Alignment:
| Q |
1 |
ccatcacaaggaa-cgatatacatcaaacaaaagcaacccctt-gaatttttgtccctctaatcctttccacatgtatgattaacagcttaaggcaattg |
98 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7566070 |
ccatcacaaggaaacaatatacatcaaacaaaagcaacccctttgaatttttgtccctctaatcctttccacatgtatgattaacagcttaaggcaattg |
7565971 |
T |
 |
| Q |
99 |
ttgtggagtcttcagctttggtggagtttggcccatctcgccactactggtgaagctgctggtgttagattcatggctggaaaacactgtctttctcatc |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7565970 |
ttgtggagtcttcagctttggtggagtttggcccatctcgccactactggtgaagctgctggtgttagattcatggctggaaaacactgtctttctcatc |
7565871 |
T |
 |
| Q |
199 |
ttctggatatcactgttgtactg |
221 |
Q |
| |
|
||||| ||||||||||||||||| |
|
|
| T |
7565870 |
ttctgcatatcactgttgtactg |
7565848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University