View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14737_low_12 (Length: 296)
Name: NF14737_low_12
Description: NF14737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14737_low_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 23 - 283
Target Start/End: Complemental strand, 11099191 - 11098931
Alignment:
| Q |
23 |
aacccccaaggctgacgaatcaaaaggtattgattgaggataagcatgctagcgaaactctggattccttgccgatcaccgtaagtgatggggccatggt |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
11099191 |
aacccccaaggctgacgaatcaaaaggtattgattgaggataagcatgctagggaaactctggattccttgctgatcatcgtaagtgatggggccatggt |
11099092 |
T |
 |
| Q |
123 |
ggacgaggggttgcaaaatggccggacatatgaaaacctacgtataattattcttttattgattaaggatgagacactctctgcctctacatataggatt |
222 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11099091 |
ggacgaggggttgcaaaatggcgggacatatgaaaacctacgtgtaattattcttttattgattaaggatgagacactctctgcctctacatataggatt |
11098992 |
T |
 |
| Q |
223 |
ctaagaatgaggaggcccttcacatcaccatgacttttatatttctttctttattttgttg |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11098991 |
ctaagaatgaggaggcccttcacatcaccatgacttttatatttctttctttattttgttg |
11098931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 173 - 262
Target Start/End: Complemental strand, 36693438 - 36693349
Alignment:
| Q |
173 |
ttcttttattgattaaggatgagacactctctgcctctacatataggattctaagaatgaggaggcccttcacatcaccatgacttttat |
262 |
Q |
| |
|
||||||| ||||| ||| ||||| |||| ||||| | |||||||||||| ||||| |||||||||||| | | |||||| |||||||| |
|
|
| T |
36693438 |
ttcttttgatgattcaggctgagatactccctgccaccgcatataggattccaagaaggaggaggccctttagagcaccataacttttat |
36693349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 173 - 261
Target Start/End: Complemental strand, 36682471 - 36682383
Alignment:
| Q |
173 |
ttcttttattgattaaggatgagacactctctgcctctacatataggattctaagaatgaggaggcccttcacatcaccatgactttta |
261 |
Q |
| |
|
||||||| ||||| ||| ||||| |||| ||||| | |||||||||||| ||||| |||||||||||| | | |||||| ||||||| |
|
|
| T |
36682471 |
ttcttttgatgattcaggctgagatactccctgccaccgcatataggattccaagaaggaggaggccctttagagcaccataactttta |
36682383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 173 - 262
Target Start/End: Complemental strand, 435681 - 435592
Alignment:
| Q |
173 |
ttcttttattgattaaggatgagacactctctgcctctacatataggattctaagaatgaggaggcccttcacatcaccatgacttttat |
262 |
Q |
| |
|
||||||| ||||| ||| ||||| |||| ||||| | |||||||||||| ||||| |||||||||||| | | |||||| |||||||| |
|
|
| T |
435681 |
ttcttttgatgattcaggctgagatactccctgccaccgcatataggattccaagaaggaggaggccctttagagcaccataacttttat |
435592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University