View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14737_low_15 (Length: 243)
Name: NF14737_low_15
Description: NF14737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14737_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 19 - 231
Target Start/End: Complemental strand, 7566285 - 7566074
Alignment:
| Q |
19 |
atacgtatagaaagaaacttgattcaataatacagagtagttaatcatgtctatgcactccattccaaggtatgcctatgtataatcattattacattac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7566285 |
atacgtatagaaagaaacttgattcaataatacagagtagttaatcatgtctatgcactccattccaaggtatgcctatgtataatcattattacattac |
7566186 |
T |
 |
| Q |
119 |
ataataaccagtgaacaaattaatgaaatatgtcacgttggcataaacttacacctcaaatacaccccgaaacagagcctcaaactcaaattctccacag |
218 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
7566185 |
ataataaccagtgaacaaattaaagaaatatgtcacgttggcataaacttacacctcaaatacaccccg-aacagagcctcaaactcaaattctccacag |
7566087 |
T |
 |
| Q |
219 |
aatgatatattac |
231 |
Q |
| |
|
||||||||||||| |
|
|
| T |
7566086 |
aatgatatattac |
7566074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University