View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14737_low_6 (Length: 434)
Name: NF14737_low_6
Description: NF14737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14737_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 384; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 384; E-Value: 0
Query Start/End: Original strand, 20 - 427
Target Start/End: Original strand, 31607336 - 31607743
Alignment:
| Q |
20 |
gattggtggatccttgggcagcaatattgatgggagctttgtccggctcaattccatggtacacgatgatggtgttgcacaaaagatcgtcattctttca |
119 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
31607336 |
gattggtggatccatgggcagcaatattgatgggagctttgtccggttcaattccatggtacacgatgatggtgttgcacaaaaaatcaccattctttca |
31607435 |
T |
 |
| Q |
120 |
aagtgtagatgatacattaggagtctttcacactcatgctgtggctggtattcttgggggaatcctttctggtgtgtttgccaaacctaaacttttgagg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31607436 |
aagtgtagatgatacattaggagtctttcacactcatgctgtggctggtattcttgggggaatcctttctggtgtgtttgccaaacctaaacttttgagg |
31607535 |
T |
 |
| Q |
220 |
attctctatggtccttatgggtctggcttattgtatagttattttgatgataatataggtcaaggaatcaagcaaatgtggtaccaattattaggagcag |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31607536 |
attctctatggtccttatgggtctggcttattgtatagttattttgatgataatataggtcaaggaatcaagcaaatgtggtaccaattattaggagcag |
31607635 |
T |
 |
| Q |
320 |
tttttattactatttggaatgttgttattactagtctgatttgtattcttttaaatcgctttgtgaatcttcgaatgcaagaagaagagcttgaggttgg |
419 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
31607636 |
tttttattactatttggaatgttgttattactagtctgatttgtattcttttaaatcgctttgtgaatcttcgaatgcaagaagaagaccttgaggttgg |
31607735 |
T |
 |
| Q |
420 |
tgatgatg |
427 |
Q |
| |
|
|||||||| |
|
|
| T |
31607736 |
tgatgatg |
31607743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University