View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14738_high_16 (Length: 306)
Name: NF14738_high_16
Description: NF14738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14738_high_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 138 - 290
Target Start/End: Original strand, 3451391 - 3451543
Alignment:
| Q |
138 |
gtgtatatgcttattattcctgtctcccatatcttcatagataagaaaactagtactagttcaattatgccttttttgtccatgtcgtgtgatcttcaac |
237 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3451391 |
gtgtatatgcttattattcctttctcccatatcttcatagataagaaaactagtactagttcgattatgccttttttgtccatgtcgtgtgatcttcaac |
3451490 |
T |
|
| Q |
238 |
actcttgttctgatcatgttcacgagcacgcgaaacatcttctaccaatctct |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3451491 |
actcttgttctgatcatgttcacgagcacgcgaaacatcttctaccaatctct |
3451543 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 138 - 169
Target Start/End: Original strand, 3451343 - 3451374
Alignment:
| Q |
138 |
gtgtatatgcttattattcctgtctcccatat |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
3451343 |
gtgtatatgcttattattcctgtctcccatat |
3451374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University