View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14738_high_21 (Length: 257)
Name: NF14738_high_21
Description: NF14738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14738_high_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 1 - 187
Target Start/End: Complemental strand, 25884861 - 25884678
Alignment:
| Q |
1 |
tggtttggaggtggttgctgctttgctataagtctattgtttggtgtatttttgtgtctctcgtgatactttaatttttctctaaagctaaactactccc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||| || |
|
|
| T |
25884861 |
tggtttggaggtggttgctgctttgctataagtctattgtttggtgtatttttgtgtctctcgtgatgctttaatttttctctaacgctaaacta---cc |
25884765 |
T |
 |
| Q |
101 |
aaataatttcatttcctactttaatatgttcattccaaacgtgctaatcatgtatttcatggttgaattccacctaatttctttgct |
187 |
Q |
| |
|
||||||||||||||||||||||||| ||| |||||||| |||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
25884764 |
aaataatttcatttcctactttaatgcgttgattccaaaggtgctaatcatgtatttcatggttgacttccacctaatttctttgct |
25884678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University