View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14738_high_27 (Length: 226)
Name: NF14738_high_27
Description: NF14738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14738_high_27 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 7 - 226
Target Start/End: Original strand, 866837 - 867052
Alignment:
| Q |
7 |
ggaatcacttctaacaaagaaagttcttgctgaatttaataatcatcgacacttcaaattaaaaatttgtttaggatctgacacttgtgtcagtgtcagt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
866837 |
ggaatcacttctaacaaagaaagttcttgctgaatttaataatcatcgacacttcagattaaaaatttgtttaggatctgacacttgtgtcagtgt---- |
866932 |
T |
 |
| Q |
107 |
gtttggcatcggcaaatgttttata--ttcaattatttattttcttaaatagtatcagtgtcaatgtggtgtttggtgtctatatgcttcatagatatta |
204 |
Q |
| |
|
||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
866933 |
--ttggcatcggcaaatgttttatatattcaattctttattttcttaaatagtatcagtgtcaatgtggtgtttggtgtctatatgcttcatagatatta |
867030 |
T |
 |
| Q |
205 |
cattcaaaggattatcgtataa |
226 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
867031 |
tattcaaaggattatcgtataa |
867052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University