View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14738_low_20 (Length: 292)
Name: NF14738_low_20
Description: NF14738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14738_low_20 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 79; Significance: 6e-37; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 10 - 132
Target Start/End: Original strand, 27717959 - 27718080
Alignment:
| Q |
10 |
agcaaaggaagaaagtgcaaacggcggttggagattagattgctttgcaaagcggattcaaaacggatgcggggagattatttcggttaaatatatcagc |
109 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||| |||||||| |||| ||||| ||||| |||||| || |||||||||| ||| |
|
|
| T |
27717959 |
agcaaaggaagaaagtgcaaatggcggttggagattagattgctttgc-aagcggatgcaaattggatggggggatattattgcgtttaaatatattagc |
27718057 |
T |
|
| Q |
110 |
ctaaaagatgttaacctaatatt |
132 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
27718058 |
ctaaaagatgttaacctaatatt |
27718080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 215 - 285
Target Start/End: Original strand, 27718193 - 27718263
Alignment:
| Q |
215 |
ataatataatattttatcattatagtgttgcataaataaattactagttgaatcaaataaaacgttccttt |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
27718193 |
ataatataatattttatcattatagtgttgcataaataaattactagttcaatcaaataaaacgttccttt |
27718263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 17 - 60
Target Start/End: Original strand, 27084977 - 27085020
Alignment:
| Q |
17 |
gaagaaagtgcaaacggcggttggagattagattgctttgcaaa |
60 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
27084977 |
gaagagagtgcaaacggcggttggagatgagattcctttgcaaa |
27085020 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University