View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14738_low_21 (Length: 287)
Name: NF14738_low_21
Description: NF14738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14738_low_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 10 - 229
Target Start/End: Original strand, 47775415 - 47775634
Alignment:
| Q |
10 |
catcatcaaagcttcactgtgcttcaagtaaatgagtacaacaaaccactagtggcaactttaaatacaggaccaccttcaattgcaatcggcgcctcat |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47775415 |
catcatcaaagcttcactgtgcttcaagtaaatgagtacaacaaaccactagtggcaactttaaatacaggaccaccttcaattgcaatcggcgcctcat |
47775514 |
T |
 |
| Q |
110 |
tatctacacctcaacaaatcagaattaaattctttaataccgttttaaaagttgcctggagtttggtataagggctcaagtaagtcataaaggaccgaca |
209 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
47775515 |
tatttacacctcaacaaatcagaattaaattctttaataccgttttaaaagttgcctggagtttggtataagggctgaagtaagtcataaaggaccgaca |
47775614 |
T |
 |
| Q |
210 |
ttcaaactctgtaaaggaga |
229 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
47775615 |
ttcaaactctgtaaaggaga |
47775634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University