View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14739_high_33 (Length: 229)
Name: NF14739_high_33
Description: NF14739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14739_high_33 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 18 - 213
Target Start/End: Complemental strand, 36170609 - 36170414
Alignment:
| Q |
18 |
ttctgagtatctgacatatttttccgataagcatatgcataactaggagtatttgcagaatatttttatgtttaagcaatgtttactacaggtagacctt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36170609 |
ttctgagtatctgacatatttttccgataagcatatgcataactaggagtatttgcagaatatttttatgtttaagcaatgtttactacaggtagacctt |
36170510 |
T |
|
| Q |
118 |
tcccttctcatctatcagtattcagtggtcttccttaattcaacttacaagtagtactttccgttttccgtttctaacaaaaacaccggctgttat |
213 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36170509 |
ttccttctcatctatcagtattcagtggtcttccttaattcaacttataagtagtactttccgttttccgtttctaacaaaaacaccggctgttat |
36170414 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University