View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14739_low_16 (Length: 355)
Name: NF14739_low_16
Description: NF14739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14739_low_16 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 296; Significance: 1e-166; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 1 - 352
Target Start/End: Complemental strand, 23141397 - 23141046
Alignment:
| Q |
1 |
tctcccaatgacatctctaacaacactctcccattaccaccccctttcttccttcaaacttcataaaccaatacactctctttcactctcactctcacgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||| || ||||||||||||||| |||||||||||| |
|
|
| T |
23141397 |
tctcccaatgacatctctaacaacactctcccattaccatcccctttcttccttcaaaattcataaacaaacacactctctttcactttcactctcacgt |
23141298 |
T |
|
| Q |
101 |
gttcctattcgtccattacaattccaattcaaaccaaaaccactatcattatctcgttcacgttttcttctttctcaatctctgccacgtgcttatatta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
23141297 |
gttcctattcgtccattacaattccaattcaaaccaaaaccactatcattatctcgttcacgttttcttctttctcaatctctgccacgtgcttatatca |
23141198 |
T |
|
| Q |
201 |
ctggacccgcgtccgacccgaatgtagctgaaccggatctgaaagttgatgggttgcaacaagaggaagcggttataccgaaagttgtaacatgggagct |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
23141197 |
gtggacccgcgtccgacccgaatgtagctgaaccggatccgaaagttgatgggttgcagcaagaagaagcggttataccgaaagttgtaacatgggagct |
23141098 |
T |
|
| Q |
301 |
gctggttttgcttttgtttaagcataaatttcggattgcgctctgtgctgct |
352 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| ||||| |||| |||| |
|
|
| T |
23141097 |
gctgggtttgcttttgtttaagcataaatttcggatagcgctttgtgttgct |
23141046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University