View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14739_low_35 (Length: 235)
Name: NF14739_low_35
Description: NF14739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14739_low_35 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 44735042 - 44735263
Alignment:
| Q |
1 |
aataactcctaatgtgctcatgattttctccattaaaattcattccattcatcatcaatgctaacaaaatatatgcactgnnnnnnnnnnnn--ggtaca |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
44735042 |
aataactcctaatgtgctcatgattttctccattaaaattcattccattcatcatcaatgccaacaaaatatatgcactgttttttttttttttggtaca |
44735141 |
T |
|
| Q |
99 |
tatgaattattagtgatatgtgcagaatgattaccttgtaccatttgacctcttgagtgattatcgcctaatgttgagaaagggaatatgggctctccta |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
44735142 |
tatgaattattagtgatatgtgcagaatgattaccttgtaccatttgacctcttgagtgattatcgccgaatgttgagaaagggaatatgggctctccta |
44735241 |
T |
|
| Q |
199 |
agatatagtagtttccaaaacc |
220 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
44735242 |
agatatagtagtttccaaaacc |
44735263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University