View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14739_low_7 (Length: 426)
Name: NF14739_low_7
Description: NF14739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14739_low_7 |
 | |
|
| [»] chr6 (2 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 136 - 426
Target Start/End: Original strand, 13766383 - 13766676
Alignment:
| Q |
136 |
aaggtccttgctttgcgtttagctcatatcatggagaaaattattttcgccaaccaatcggccttcgttagagggagacaacatgtagatggggttgtgg |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13766383 |
aaggtccttgctttgcgtttagctcatatcatggagaagattattttcgtaaaccaatcgaccttcgttagagggagacaacatgtagatggggttgtgg |
13766482 |
T |
|
| Q |
236 |
ctgtaaatgagattattgttttgaggggagatggggtcgtgga-tatagtgtgtgtgtttacaggtagcctgctgtcctggtcaattgttctcctaccta |
334 |
Q |
| |
|
|| ||||||||||||||||||||| |||||||||||||||||| || |||||||||||||| | |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
13766483 |
ctataaatgagattattgttttgatgggagatggggtcgtggactagagtgtgtgtgtttataagtagcctgctatcctggtcaattgttctcctaccta |
13766582 |
T |
|
| Q |
335 |
agaaatagacattcaaaaagggctcaagcaaggag--acggtgttttttgtctgtgaagaagaacttttgactggtatggtggatattcttcga |
426 |
Q |
| |
|
|||||| || ||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
13766583 |
agaaatcgatattcaaaaagggctcaagcaaggagacacggtgttttttgtctatgaggaagaacttttgactggtatggtggatatccttcga |
13766676 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 110; E-Value: 3e-55
Query Start/End: Original strand, 23 - 136
Target Start/End: Original strand, 13766234 - 13766347
Alignment:
| Q |
23 |
ttatgtttgagcaattttatactccagcaaatctgcttaagatcttctcctaatactttgttaccttgatctctaaggttgaatatcccatacttttagg |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13766234 |
ttatgtttgagcaattttatactccagcaaatctgcttaagatcttctcctaatactttcttaccttgatctctaaggttgaatatcccatacttttagg |
13766333 |
T |
|
| Q |
123 |
ggattttagcctga |
136 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
13766334 |
ggattttagcctga |
13766347 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University