View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14740_high_13 (Length: 215)

Name: NF14740_high_13
Description: NF14740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14740_high_13
NF14740_high_13
[»] chr4 (1 HSPs)
chr4 (19-200)||(53006167-53006348)


Alignment Details
Target: chr4 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 19 - 200
Target Start/End: Original strand, 53006167 - 53006348
Alignment:
19 aaaaaacatttgatatgcaatgttacctttcaaatgttttgtcaacttatcatataagtagataagttgagtgtcttattgtctcttaataccctacata 118  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
53006167 aaaaaacatttgatatgcactgttacctttcaaatgttttgtcaacttatcatataagtagataagttgagtctcttattgtctcttaataccctacata 53006266  T
119 gtatagtattacatttttaatgtttactatatgaattcttatgtgctcccctgcctgcacgatggaaacaaacgtggttcat 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53006267 gtatagtattacatttttaatgtttactatatgaattcttatgtgctcccctgcctgcacgatggaaacaaacgtggttcat 53006348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University