View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14740_low_11 (Length: 307)
Name: NF14740_low_11
Description: NF14740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14740_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 18 - 293
Target Start/End: Original strand, 36728012 - 36728292
Alignment:
| Q |
18 |
atggtggaattcaggttctactgaccaagagttttcaaacatgaaatatttttcctaaaaatatggaacattcttcggctcacaagagagcaataaagga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36728012 |
atggtggaattcaggttctactgaccaagagttttcaaacatgaaatatttttcctaaaaatatggaacattcttcggctcacaagagagcaataaagga |
36728111 |
T |
|
| Q |
118 |
taatgataggaagcagtaatagttaagcactctgaaaacatactacaccagttgtttatagtcattgtatggtcgagttacccctccatattca---aat |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
36728112 |
taatgataggaagcagtaatagttaagcactctgaaaacatactacaccagttgtttatagtcattgtatggtcgagttacccctccatattcaaataat |
36728211 |
T |
|
| Q |
215 |
caatcaaacccgcatttgttaatgcctcacggaaacc---attgatgagcttattttgatctatccgtcctgcctctttttt |
293 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| ||||||||||||| ||||||||||||| |||||| ||||||| |
|
|
| T |
36728212 |
caatcaaacccacatttgttaatgcctcacggaaaccaatattgatgagctta-tttgatctatccgccctgcccctttttt |
36728292 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University