View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14740_low_15 (Length: 224)
Name: NF14740_low_15
Description: NF14740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14740_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 66 - 204
Target Start/End: Original strand, 41231438 - 41231576
Alignment:
| Q |
66 |
cacacaagaagaacaaattgaaatgtgttgtcacagtcactatcaagtaataattttgttgtagtgtcccaaaatgtgttactaataggcacatatttaa |
165 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41231438 |
cacataagaagaacaaattgaaatgtgttgtcacagtcactatcaagtaataattttgttgtagtgtcccaaaatgtgttactaataggcacatatttaa |
41231537 |
T |
 |
| Q |
166 |
attcaggttttacgttttttctatgtactaggtaggagc |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41231538 |
attcaggttttacgttttttctatgtactaggtaggagc |
41231576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 14 - 52
Target Start/End: Original strand, 41231285 - 41231323
Alignment:
| Q |
14 |
aagaatatatggctttttgatataagagttctcaatagt |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
41231285 |
aagaatatatggctttttgatataagagttctcattagt |
41231323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University