View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14741_low_13 (Length: 240)
Name: NF14741_low_13
Description: NF14741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14741_low_13 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 18 - 240
Target Start/End: Original strand, 34866239 - 34866459
Alignment:
| Q |
18 |
aactcctgcatagcacaaggttttattgctttatatatttctaataggaataagtaatctcgtattcgataagtattgaagcacttgcaaaaccggctac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34866239 |
aactcctgcatagcacaaggttttattgctttatatatttctaataggaataagtaatctcgtattcgataagtattgaagcacttgcaaaaccggctac |
34866338 |
T |
 |
| Q |
118 |
actacaaagctttactcgagctttccagttagcccttctgtaggtagcactttgtgagacatcgacaaccagtctctctgataccatttgataagtagtc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
34866339 |
actacaaagctttactcgagctttccagttagcccttctgtaggtagcactttgtgagacatcgacaaccag--tctctgataccatttgataagtagtc |
34866436 |
T |
 |
| Q |
218 |
gagagcctttgaagaaatctccc |
240 |
Q |
| |
|
|||||| |||| ||||||||||| |
|
|
| T |
34866437 |
gagagcatttggagaaatctccc |
34866459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University