View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14741_low_16 (Length: 221)
Name: NF14741_low_16
Description: NF14741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14741_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 18 - 202
Target Start/End: Original strand, 5481079 - 5481263
Alignment:
| Q |
18 |
acatgtgagatagacacaacacataccacaagttcaacaacatcgatggcagaaagattggaacgaagagcagagatgccaagattgagaacacgagtaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5481079 |
acatgtgagatagacacaacacataccacaagttcaacaacatcgatggcagaaagattggaacgaagagcagagatgccaagattgagaacacgagtaa |
5481178 |
T |
|
| Q |
118 |
gaagttgtttggcttcttcttgacgttgaagagggagattagggtcaacaccagcaccaccatgcacagcaattgcccaaccacc |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5481179 |
gaagttgtttggcttcttcttgacgttgaagagggagattagggtcaacaccagcaccaccatgcacagcaattgcccaaccacc |
5481263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 38 - 200
Target Start/End: Original strand, 42165571 - 42165733
Alignment:
| Q |
38 |
acataccacaagttcaacaacatcgatggcagaaagattggaacgaagagcagagatgccaagattgagaacacgagtaagaagttgtttggcttcttct |
137 |
Q |
| |
|
|||||| ||||||||||| ||||||| |||||| ||||||||| |||||| | ||||||| ||| ||| | ||||||||||||||||||||||||| |
|
|
| T |
42165571 |
acatacaacaagttcaacgacatcgacagcagaaccattggaacggagagcaaatatgccaatattaagacaatgagtaagaagttgtttggcttcttcc |
42165670 |
T |
|
| Q |
138 |
tgacgttgaagagggagattagggtcaacaccagcaccaccatgcacagcaattgcccaacca |
200 |
Q |
| |
|
|||||||| | ||||||||||| || ||||| || ||||||||||||||||| ||||||||| |
|
|
| T |
42165671 |
tgacgttgtggtgggagattaggatccacaccggcgccaccatgcacagcaatagcccaacca |
42165733 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 74 - 200
Target Start/End: Complemental strand, 47170309 - 47170183
Alignment:
| Q |
74 |
attggaacgaagagcagagatgccaagattgaga-acacgagtaagaagttgtttggcttcttcttgacgttgaagagggagattagggtcaacaccagc |
172 |
Q |
| |
|
|||||| || ||||||||||| || ||||||||| | || |||||||| ||||||||||||| ||||| || | ||||| ||||| || ||||| || |
|
|
| T |
47170309 |
attggatcggagagcagagataccgagattgagacattcg-gtaagaagctgtttggcttcttgctgacggtgtggtgggaggttaggatccacacctgc |
47170211 |
T |
|
| Q |
173 |
accaccatgcacagcaattgcccaacca |
200 |
Q |
| |
|
||| ||||| |||||||| ||||||||| |
|
|
| T |
47170210 |
accgccatgaacagcaatagcccaacca |
47170183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University