View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14741_low_6 (Length: 422)
Name: NF14741_low_6
Description: NF14741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14741_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 101; Significance: 6e-50; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 101; E-Value: 6e-50
Query Start/End: Original strand, 304 - 404
Target Start/End: Original strand, 16006015 - 16006115
Alignment:
| Q |
304 |
atggttagttcaagtatgattgtgaacccattttttgtgtttaagtgggacaaaattaccttattgtttaatacttccaattaattaaccaaggttcagt |
403 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16006015 |
atggttagttcaagtatgattgtgaacccattttttgtgtttaagtgggacaaaattaccttattgtttaatacttccaattaattaaccaaggttcagt |
16006114 |
T |
|
| Q |
404 |
t |
404 |
Q |
| |
|
| |
|
|
| T |
16006115 |
t |
16006115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 1 - 108
Target Start/End: Original strand, 16005809 - 16005916
Alignment:
| Q |
1 |
aacaagctgaagaagttgcacagaatctggaggctgaacaagatgaagtttgatttgatattttttccatgactttactttagtttctttcccgagagat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
16005809 |
aacaagctgaagaagttgcacagaatctggaggctgaacaagatgaagtttgatttgatatttttgccatgactttactttagtttctttcccaagagat |
16005908 |
T |
|
| Q |
101 |
atttgtgc |
108 |
Q |
| |
|
|||||||| |
|
|
| T |
16005909 |
atttgtgc |
16005916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University