View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14742_high_20 (Length: 241)
Name: NF14742_high_20
Description: NF14742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14742_high_20 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 41169147 - 41168917
Alignment:
| Q |
1 |
aaataagataattgatcatatattttgannnnnnnngtcaaattttgatgttaaatttatttctcacaactcgtccatttttaacgtttgattacggaat |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
41169147 |
aaataatataattgatcatatattttgattttttttgtcaaattttgatgttaaatttatttctcacaactcttccatttttaacgtttgattacggaat |
41169048 |
T |
|
| Q |
101 |
gattattcgttgagcgtttgcctttcatttgaacaattagtactagtacattgataaagcatctagagtctagactaataattaagtgtctaaaatattc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41169047 |
gattattcgttgagcgtttgcctttcatttgaacaattggtactagtacattgataaagcatctagagtctagactaataattaagtgtctaaaatattc |
41168948 |
T |
|
| Q |
201 |
ttttacaaaacaaaggtgtaaaacattcatt |
231 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |
|
|
| T |
41168947 |
ttttacaaagcaaaggtgtaaaacattcatt |
41168917 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University