View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14742_low_19 (Length: 310)
Name: NF14742_low_19
Description: NF14742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14742_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 76; Significance: 4e-35; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 1 - 84
Target Start/End: Original strand, 4737199 - 4737282
Alignment:
| Q |
1 |
ttaaatttcatcttgaattctatgttgggacttttgactgtccacatgctttcaaaacaactgggcaataaaggggactaattg |
84 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4737199 |
ttaaatttcatcttgaattctatgttgggacttttcactgtccacatgctttcaaaacaaatgggcaataaaggggactaattg |
4737282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 47; Significance: 8e-18; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 172 - 230
Target Start/End: Complemental strand, 2806587 - 2806529
Alignment:
| Q |
172 |
atcgtggcctatttacttggtagaatttgttggtcacacctaattaatagggtatacag |
230 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| | ||||||| |
|
|
| T |
2806587 |
atcgtggcctatttacttggtagagtttgttggtcacacctaattaatatgctatacag |
2806529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 139 - 171
Target Start/End: Complemental strand, 2806639 - 2806607
Alignment:
| Q |
139 |
ctaaaccgttttcttttgaccaagttatttagc |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
2806639 |
ctaaaccgttttcttttgaccaagttatttagc |
2806607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 139 - 171
Target Start/End: Complemental strand, 34154371 - 34154339
Alignment:
| Q |
139 |
ctaaaccgttttcttttgaccaagttatttagc |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
34154371 |
ctaaaccgttttcttttgaccaagttatttagc |
34154339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 216 - 250
Target Start/End: Complemental strand, 34154331 - 34154297
Alignment:
| Q |
216 |
taatagggtatacagttttgcaacgttattatatt |
250 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |
|
|
| T |
34154331 |
taatagggcatacagttttgcaacgttattatatt |
34154297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University