View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14742_low_27 (Length: 243)
Name: NF14742_low_27
Description: NF14742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14742_low_27 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 81 - 230
Target Start/End: Complemental strand, 1814378 - 1814229
Alignment:
| Q |
81 |
tgaggggacaaggacaatttctagtttcagtttattgcttaactcaccaattttggaatataacagtggattagcatataagtgagcatatcaaagcacn |
180 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1814378 |
tgaggggacaaggacaatttctagttgcagtttattgcttaactcaccaatgttggaatataacagtggattagcatataagtgagcatatcaaagcaca |
1814279 |
T |
 |
| Q |
181 |
nnnnnnnggagtttataaaaaagataacaaccaaccacaagtcacctatg |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1814278 |
aaaaaaaggagtttataaaaaagataacaaccaaccacaagtcacctatg |
1814229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 193 - 229
Target Start/End: Complemental strand, 1829526 - 1829490
Alignment:
| Q |
193 |
ttataaaaaagataacaaccaaccacaagtcacctat |
229 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1829526 |
ttataacaaagataacaaccaaccacaagtcacctat |
1829490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University