View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14742_low_33 (Length: 232)

Name: NF14742_low_33
Description: NF14742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14742_low_33
NF14742_low_33
[»] chr3 (1 HSPs)
chr3 (24-216)||(2510445-2510637)


Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 24 - 216
Target Start/End: Original strand, 2510445 - 2510637
Alignment:
24 tctcttggatggttgtcgtcaactatatgacatggaaaacaatggtgtaaaatacaagatgcatatttgtgcaaagaatgaaaataataatattcatgaa 123  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2510445 tctcttggatggttgtcgtcaactatatgacatggaaaacaatggtgtaaaatacaagatgcatatttgtgcaaagaatgaaaataataatattcatgaa 2510544  T
124 ggaaggttatggataaatcccagactctattttcaaatttttgcatttgcctatctctttatatgttctcatgtcttaaattgcacttatatt 216  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
2510545 ggaaggttatggataaatccgagactctattttcaaatttttgcatttgcctatctctttatatgttctcatgtcttaaattgtacttatatt 2510637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University