View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14743_high_11 (Length: 204)
Name: NF14743_high_11
Description: NF14743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14743_high_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 77; Significance: 6e-36; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 77; E-Value: 6e-36
Query Start/End: Original strand, 96 - 188
Target Start/End: Complemental strand, 16841649 - 16841557
Alignment:
| Q |
96 |
tagatccaagtctttatgaaatttctgttagactcttatcaacctcgtcaaattttgttggatgttttgacaatatatgaataagccaataac |
188 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16841649 |
tagatccaagactttatgagatttctgttagactcttatcaacctcatcaaattatgttggatgttttgacaatatatgaataagccaataac |
16841557 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 15 - 57
Target Start/End: Complemental strand, 16841702 - 16841660
Alignment:
| Q |
15 |
agatgaatagatttatcgatatttttgaaagatccaagtcttt |
57 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16841702 |
agatgaatagatttatcgatatttttgaaagatccaagtcttt |
16841660 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University